Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene
DOI:
https://doi.org/10.24002/biota.v15i3.2591Keywords:
Theobroma cacao L., Cherelle wilt, DNA, RNA, TcPIN1Abstract
This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.Downloads
Published
15-10-2019
How to Cite
Astuti, Y. T., Dewi, K., Santosa, S., & Prawoto, A. A. (2019). Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene. Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati, 15(3), 363–368. https://doi.org/10.24002/biota.v15i3.2591
Issue
Section
Articles
License
Authors who publish with Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati agree to the following terms:
- Authors retain copyright and grant the Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati right of first publication. Licensed under a Creative Commons Attribution-NonCommercial 4.0 International License that allows others to share the work with an acknowledgment of the work's authorship and initial publication in this journal.
- Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal's published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgment of its initial publication in Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati, and as long as Author is not used for commercial purposes.










