Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene

Authors

  • Yohana Theresia Astuti
  • Kumala Dewi
  • Santosa Santosa
  • A. Adi Prawoto

DOI:

https://doi.org/10.24002/biota.v15i3.2591

Keywords:

Theobroma cacao L., Cherelle wilt, DNA, RNA, TcPIN1

Abstract

This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.

Downloads

Published

15-10-2019

How to Cite

Astuti, Y. T., Dewi, K., Santosa, S., & Prawoto, A. A. (2019). Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene. Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati, 15(3), 363–368. https://doi.org/10.24002/biota.v15i3.2591

Issue

Vol 15, No 3 (2010): October 2010

Section

Articles

License

Authors who publish with Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati agree to the following terms:

  • Authors retain copyright and grant the Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati right of first publication. Licensed under a Creative Commons Attribution-NonCommercial 4.0 International License that allows others to share the work with an acknowledgment of the work's authorship and initial publication in this journal.
  • Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal's published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgment of its initial publication in Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati, and as long as Author is not used for commercial purposes.