Keragaman Daerah Kontrol DNA Mitokondria Rusa Timor (Cervus timorensis timorensis) di Pulau Timor, Alor, dan Pantar
DOI:
https://doi.org/10.24002/biota.v12i3.2799Keywords:
Cervus timorensis timorensis, mitochondrial DNA, region diversityAbstract
A study on mtDNA control region diversity of the timor deer was conducted in East
Nusa Tenggara Province. Sample consisted of 20 individuals from 3 islands (Timor,
Pantar, and Alor). Total DNA were extracted from leucocyte (buffy coat). Fragment
control region of the mitochondrial DNA were amplified by Polymerase Chain
Reaction (PCR) using primers of forward primer
5”AAACCAGAAAAGGAGAGCAAC3” and reverse primer
5”TCATCTAGGCATTTTCAGTGCC3”. Nucleotide sequence of the mitochondrial
control region were aligned by using ClastalX and phylogenetic analyses by Neighbor-
Joining methode. Kimura two-parameter model of nucleotide substitution using
pairwise distance calculation program was implemented with the Mega software
version 3. The purposes of this study, were to examine the control region (D-Loop) of
the mitochondrial DNA and to discuss the phylogeography of the Cervus timorensis
timorensis in East Nusa Tenggara Province. Results indicated that from 435 base
nucleotide sequences, 16 polymorphic sites with 8 haplotypes were found among 3
islands. Haplotype diversity and nucleotide diversity were 0.056 and 0.039. DNA
distances values ranged from 0.014 to 0.021.
Downloads
Published
How to Cite
Issue
Section
License
Authors who publish with Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati agree to the following terms:
- Authors retain copyright and grant the Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati right of first publication. Licensed under a Creative Commons Attribution-NonCommercial 4.0 International License that allows others to share the work with an acknowledgment of the work's authorship and initial publication in this journal.
- Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal's published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgment of its initial publication in Biota : Jurnal Ilmiah Ilmu-Ilmu Hayati, and as long as Author is not used for commercial purposes.










